Stem-loop sequence hsa-mir-3144

AccessionMI0014169 (change log)
Symbol HGNC:MIR3144
DescriptionHomo sapiens miR-3144 stem-loop
Literature search

1 open access papers mention hsa-mir-3144
(1 sentences)

Stem-loop
                       a  g  a       auau 
5' aacuacacuuuaaggggacc aa ag uauauag    c
   |||||||||||||||||||| || || |||||||    a
3' uugaugugaaauuucucugg uu uc auauauc    g
                       c  g  c       cauc 
Get sequence
Deep sequencing
485 reads, 3.57 reads per million, 56 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 120015179-120015257 [+]
intergenic
Database links

Mature sequence hsa-miR-3144-5p

Accession MIMAT0015014
Sequence

13 - 

aggggaccaaagagauauauag

 - 34

Get sequence
Deep sequencing344 reads, 35 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-3144-3p

Accession MIMAT0015015
Sequence

48 - 

auauaccuguucggucucuuua

 - 69

Get sequence
Deep sequencing141 reads, 39 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).