Stem-loop sequence hsa-mir-3143

AccessionMI0014167 (change log)
Symbol HGNC:MIR3143
DescriptionHomo sapiens miR-3143 stem-loop
Stem-loop
       u            ---c     uuuc  gg 
5' uaga aacauuguaaag    gcuuc    gc  u
   |||| ||||||||||||    |||||    ||   
3' aucu uuguaacauuuc    cgagg    cg  u
       -            ucaa     ---u  gg 
Get sequence
Deep sequencing
696 reads, 172 reads per million, 86 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 27147626-27147688 [+]
intergenic
Database links

Mature sequence hsa-miR-3143

Accession MIMAT0015012
Sequence

4 - 

auaacauuguaaagcgcuucuuucg

 - 28

Get sequence
Deep sequencing623 reads, 65 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).