Stem-loop sequence hsa-mir-3142

AccessionMI0014166 (change log)
Symbol HGNC:MIR3142
DescriptionHomo sapiens miR-3142 stem-loop
Literature search

1 open access papers mention hsa-mir-3142
(6 sentences)

Stem-loop
   u    aaa            cc            --g    a 
5'  ucag   ggccuuucugaa  uucagaaaggcu   cuga u
    ||||   ||||||||||||  ||||||||||||   ||||  
3'  aguc   ucggaaagacuu  aagucuuuccgg   gacu c
   a    --g            cc            aaa    u 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 160474402-160474483 [+]
intergenic
Database links

Mature sequence hsa-miR-3142

Accession MIMAT0015011
Sequence

49 - 

aaggccuuucugaaccuucaga

 - 70

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).