Stem-loop sequence hsa-mir-3140

AccessionMI0014163 (change log)
Symbol HGNC:MIR3140
DescriptionHomo sapiens miR-3140 stem-loop
Gene family MIPF0001615; mir-3140
Stem-loop
   -c        g          a           a   a   ugaa 
5'   cucuugag uaccugaauu ccaaaagcuuu ugu uuc    g
     |||||||| |||||||||| ||||||||||| ||| |||     
3'   gaggacuu auggacuuaa gguuuucgaga aua aag    u
   gu        g          g           -   a   uuau 
Get sequence
Deep sequencing
670 reads, 0 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 152489327-152489416 [-]
antisense
OTTHUMT00000365691 ; FAM160A1-003; intron 2
OTTHUMT00000365692 ; FAM160A1-004; intron 3
OTTHUMT00000365696 ; FAM160A1-008; intron 3
OTTHUMT00000365695 ; FAM160A1-007; intron 4
ENST00000505231 ; FAM160A1-003; intron 2
ENST00000503146 ; FAM160A1-004; intron 3
ENST00000512597 ; FAM160A1-008; intron 3
ENST00000513962 ; FAM160A1-007; intron 4
ENST00000435205 ; FAM160A1-201; intron 4
Database links

Mature sequence hsa-miR-3140-5p

Accession MIMAT0019204
Sequence

12 - 

accugaauuaccaaaagcuuu

 - 32

Get sequence
Deep sequencing121 reads, 22 experiments
Evidence experimental; Illumina [3-4]
Predicted targets

Mature sequence hsa-miR-3140-3p

Accession MIMAT0015008
Previous IDshsa-miR-3140
Sequence

60 - 

agcuuuugggaauucagguagu

 - 81

Get sequence
Deep sequencing534 reads, 67 experiments
Evidence experimental; Illumina [1-4]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
4
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).