Stem-loop sequence hsa-mir-3139

AccessionMI0014162 (change log)
Symbol HGNC:MIR3139
DescriptionHomo sapiens miR-3139 stem-loop
Stem-loop
      u  gag         aaca          gacug 
5' ggc ca   uaggagcuc    gaugccuguu     a
   ||| ||   |||||||||    ||||||||||      
3' ccg gu   guuuucgag    cuauggacaa     a
      u  auu         gacg          auaau 
Get sequence
Deep sequencing
158 reads, 48.9 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 143343460-143343535 [+]
antisense
OTTHUMT00000364595 ; INPP4B-009; intron 2
OTTHUMT00000364593 ; INPP4B-007; intron 4
OTTHUMT00000364589 ; INPP4B-003; intron 4
OTTHUMT00000364592 ; INPP4B-006; intron 4
OTTHUMT00000364588 ; INPP4B-002; intron 5
OTTHUMT00000364597 ; INPP4B-011; intron 5
OTTHUMT00000364605 ; INPP4B-019; intron 5
OTTHUMT00000364604 ; INPP4B-018; intron 5
OTTHUMT00000364587 ; INPP4B-001; intron 6
ENST00000506217 ; INPP4B-009; intron 2
ENST00000308502 ; INPP4B-202; intron 2
ENST00000262992 ; INPP4B-201; intron 3
ENST00000508116 ; INPP4B-007; intron 4
ENST00000512630 ; INPP4B-003; intron 4
ENST00000510812 ; INPP4B-006; intron 4
ENST00000509777 ; INPP4B-002; intron 5
ENST00000506788 ; INPP4B-011; intron 5
ENST00000506517 ; INPP4B-019; intron 5
ENST00000506000 ; INPP4B-018; intron 5
ENST00000513000 ; INPP4B-001; intron 6
Database links

Mature sequence hsa-miR-3139

Accession MIMAT0015007
Sequence

10 - 

uaggagcucaacagaugccuguu

 - 32

Get sequence
Deep sequencing154 reads, 42 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).