Stem-loop sequence hsa-mir-3138

AccessionMI0014161 (change log)
Symbol HGNC:MIR3138
DescriptionHomo sapiens miR-3138 stem-loop
Gene family MIPF0001428; mir-3138
Literature search

4 open access papers mention hsa-mir-3138
(16 sentences)

Stem-loop
                    c c         -  -   --g  c 
5' cccuccucggcacuucc c accucacug cc cgg   ug c
   ||||||||||||||||| | ||||||||| || |||   ||  
3' gggaggagccgugaggg g uggagugac gg guc   ac c
                    a a         a  u   aga  a 
Get sequence
Deep sequencing
740 reads, 1.03 reads per million, 97 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 10078611-10078692 [-]
sense
OTTHUMT00000359881 ; WDR1-005; intron 10
OTTHUMT00000359882 ; WDR1-006; exon 11
OTTHUMT00000359878 ; WDR1-002; intron 11
OTTHUMT00000359877 ; WDR1-001; intron 14
ENST00000502962 ; WDR1-005; intron 10
ENST00000515743 ; WDR1-006; exon 11
ENST00000502702 ; WDR1-002; intron 11
ENST00000382451 ; WDR1-201; intron 11
ENST00000499869 ; WDR1-001; intron 14
ENST00000382452 ; WDR1-202; intron 14
Database links

Mature sequence hsa-miR-3138

Accession MIMAT0015006
Sequence

48 - 

uguggacagugagguagagggagu

 - 71

Get sequence
Deep sequencing684 reads, 76 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).