Stem-loop sequence hsa-mir-3137

AccessionMI0014160 (change log)
Symbol HGNC:MIR3137
DescriptionHomo sapiens miR-3137 stem-loop
Stem-loop
          c       ug      a      guauggu 
5' uacaggu uguagcc  ggagca uggggu       a
   ||||||| |||||||  |||||| ||||||        
3' augucca acaucgg  ccucgu gcuccg       u
          a       gu      -      augggga 
Get sequence
Deep sequencing
52 reads, 28.6 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 195134506-195134580 [-]
sense
OTTHUMT00000342126 ; ACAP2-001; intron 1
OTTHUMT00000342127 ; ACAP2-002; intron 1
OTTHUMT00000342233 ; ACAP2-013; intron 1
OTTHUMT00000342130 ; ACAP2-005; intron 1
OTTHUMT00000342129 ; ACAP2-004; intron 1
ENST00000326793 ; ACAP2-001; intron 1
ENST00000480906 ; ACAP2-002; intron 1
ENST00000481463 ; ACAP2-013; intron 1
ENST00000439666 ; ACAP2-005; intron 1
ENST00000447662 ; ACAP2-004; intron 1
Database links

Mature sequence hsa-miR-3137

Accession MIMAT0015005
Sequence

7 - 

ucuguagccugggagcaauggggu

 - 30

Get sequence
Deep sequencing43 reads, 18 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).