Stem-loop sequence hsa-mir-3136

AccessionMI0014158 (change log)
Symbol HGNC:MIR3136
DescriptionHomo sapiens miR-3136 stem-loop
Gene family MIPF0001575; mir-3136
Literature search

1 open access papers mention hsa-mir-3136
(1 sentences)

Stem-loop
         a                a      uuuuuc    a 
5' aauaug aacugacugaauaggu ggguca      ugug c
   |||||| |||||||||||||||| ||||||      ||||  
3' uuauac uugauugacuuaucca cccggu      acac u
         c                a      ------    g 
Get sequence
Deep sequencing
455 reads, 0 reads per million, 90 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 69048958-69049035 [-]
sense
OTTHUMT00000343725 ; EOGT-005; intron 1
OTTHUMT00000343724 ; EOGT-004; intron 8
OTTHUMT00000343722 ; EOGT-002; intron 9
OTTHUMT00000343723 ; EOGT-003; intron 9
ENST00000496647 ; EOGT-005; intron 1
ENST00000540764 ; EOGT-201; intron 5
ENST00000403140 ; EOGT-004; intron 8
ENST00000540955 ; EOGT-202; intron 8
ENST00000383701 ; EOGT-002; intron 9
ENST00000295571 ; EOGT-003; intron 9
Database links

Mature sequence hsa-miR-3136-5p

Accession MIMAT0015003
Previous IDshsa-miR-3136
Sequence

10 - 

cugacugaauagguagggucauu

 - 32

Get sequence
Deep sequencing434 reads, 87 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-3136-3p

Accession MIMAT0019203
Sequence

49 - 

uggcccaaccuauucaguuagu

 - 70

Get sequence
Deep sequencing20 reads, 11 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).