Stem-loop sequence hsa-mir-3135b

AccessionMI0016809 (change log)
Symbol HGNC:MIR3135B
DescriptionHomo sapiens miR-3135b stem-loop
Gene family MIPF0001219; mir-3135
Literature search

1 open access papers mention hsa-mir-3135b
(1 sentences)

Stem-loop
   u       cu  ag    --        u  -  uc 
5'  gcccagg  gg  cgag  ugcagugg gc ag  a
    |||||||  ||  ||||  |||||||| || ||   
3'  cgggucc  uc  gcuc  acgucacu cg uc  g
   u       --  aa    cg        -  a  cu 
Get sequence
Deep sequencing
2174 reads, 71.2 reads per million, 139 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 32749912-32749979 [-]
intergenic
Database links

Mature sequence hsa-miR-3135b

Accession MIMAT0018985
Sequence

7 - 

ggcuggagcgagugcaguggug

 - 28

Get sequence
Deep sequencing196 reads, 47 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).