Stem-loop sequence hsa-mir-3135a

AccessionMI0014156 (change log)
Previous IDshsa-mir-3135
Symbol HGNC:MIR3135A
DescriptionHomo sapiens miR-3135a stem-loop
Gene family MIPF0001219; mir-3135
Literature search

1 open access papers mention hsa-mir-3135a
(1 sentences)

Stem-loop
         u  u       ---c    a         u  aa 
5' ucacuu gg gccuagg    ugag cugcagugg gc  u
   |||||| || |||||||    |||| ||||||||| ||  c
3' agugga cu cgggucc    guuc gacgucacu ug  u
         -  -       ucca    c         -  ac 
Get sequence
Deep sequencing
2470 reads, 367 reads per million, 146 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 20137565-20137641 [+]
sense
OTTHUMT00000252880 ; KAT2B-001; intron 3
OTTHUMT00000340005 ; KAT2B-002; intron 3
ENST00000263754 ; KAT2B-001; intron 3
ENST00000426228 ; KAT2B-002; intron 3
Database links

Mature sequence hsa-miR-3135a

Accession MIMAT0015001
Previous IDshsa-miR-3135
Sequence

10 - 

ugccuaggcugagacugcagug

 - 31

Get sequence
Deep sequencing166 reads, 44 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).