Stem-loop sequence hsa-mir-3134

AccessionMI0014155 (change log)
Symbol HGNC:MIR3134
DescriptionHomo sapiens miR-3134 stem-loop
Stem-loop
   u                         c   c  gga 
5'  guauccaauguguagucuuuuaucc uca au   g
    ||||||||||||||||||||||||| ||| ||    
3'  cauggguuauacaucagaaaauagg agu ua   u
   a                         u   a  aaa 
Get sequence
Deep sequencing
163 reads, 14.3 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 15697298-15697371 [-]
intergenic
Database links

Mature sequence hsa-miR-3134

Accession MIMAT0015000
Sequence

45 - 

ugauggauaaaagacuacauauu

 - 67

Get sequence
Deep sequencing132 reads, 48 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).