Stem-loop sequence hsa-mir-3133

AccessionMI0014153 (change log)
Symbol HGNC:MIR3133
DescriptionHomo sapiens miR-3133 stem-loop
Stem-loop
        au                   c      uaaaa 
5' cagaa  uguaaagaacucuuaaaac caauag     a
   |||||  ||||||||||||||||||| ||||||      
3' gucuu  auauuucuugagaauuuug guuguc     g
        au                   a      caaca 
Get sequence
Deep sequencing
1806 reads, 0 reads per million, 100 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 241477905-241477982 [+]
antisense
OTTHUMT00000325899 ; ANKMY1-004; intron 1
OTTHUMT00000325909 ; ANKMY1-014; intron 1
OTTHUMT00000325914 ; ANKMY1-019; intron 1
OTTHUMT00000257187 ; ANKMY1-001; intron 3
OTTHUMT00000325901 ; ANKMY1-006; intron 3
OTTHUMT00000325902 ; ANKMY1-007; intron 3
OTTHUMT00000325911 ; ANKMY1-016; intron 3
OTTHUMT00000325915 ; ANKMY1-020; intron 3
OTTHUMT00000325934 ; ANKMY1-021; intron 3
OTTHUMT00000325935 ; ANKMY1-022; intron 3
OTTHUMT00000325907 ; ANKMY1-012; intron 4
OTTHUMT00000325906 ; ANKMY1-011; intron 4
OTTHUMT00000257188 ; ANKMY1-002; intron 4
OTTHUMT00000325900 ; ANKMY1-005; intron 4
OTTHUMT00000325905 ; ANKMY1-010; intron 4
OTTHUMT00000325904 ; ANKMY1-009; intron 4
ENST00000484526 ; ANKMY1-004; intron 1
ENST00000459901 ; ANKMY1-014; intron 1
ENST00000443318 ; ANKMY1-019; intron 1
ENST00000272972 ; ANKMY1-001; intron 3
ENST00000405002 ; ANKMY1-006; intron 3
ENST00000496300 ; ANKMY1-007; intron 3
ENST00000441168 ; ANKMY1-016; intron 3
ENST00000462004 ; ANKMY1-020; intron 3
ENST00000418708 ; ANKMY1-021; intron 3
ENST00000418505 ; ANKMY1-022; intron 3
ENST00000536462 ; ANKMY1-203; intron 3
ENST00000373318 ; ANKMY1-012; intron 4
ENST00000406958 ; ANKMY1-011; intron 4
ENST00000361678 ; ANKMY1-002; intron 4
ENST00000403283 ; ANKMY1-005; intron 4
ENST00000401804 ; ANKMY1-010; intron 4
ENST00000405523 ; ANKMY1-009; intron 4
ENST00000391987 ; ANKMY1-202; intron 4
ENST00000373320 ; ANKMY1-201; intron 4
Database links

Mature sequence hsa-miR-3133

Accession MIMAT0014998
Sequence

10 - 

uaaagaacucuuaaaacccaau

 - 31

Get sequence
Deep sequencing186 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).