Stem-loop sequence hsa-mir-3132

AccessionMI0014152 (change log)
Symbol HGNC:MIR3132
DescriptionHomo sapiens miR-3132 stem-loop
Gene family MIPF0001509; mir-3132
Stem-loop
              u    -a   a      a   ----c  u 
5' ggugggauggg agag  agg gcucag gga     gg g
   ||||||||||| ||||  ||| |||||| |||     ||  
3' ccacccuacuc ucuc  ucc cgaguu ccu     cc c
              -    cc   -      c   uuguu  g 
Get sequence
Deep sequencing
147 reads, 0 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 219549073-219549147 [-]
antisense
OTTHUMT00000336658 ; STK36-012; intron 1
OTTHUMT00000336656 ; STK36-010; intron 2
OTTHUMT00000256723 ; STK36-001; intron 10
OTTHUMT00000256724 ; STK36-002; intron 10
OTTHUMT00000336649 ; STK36-003; intron 10
ENST00000422778 ; STK36-012; intron 1
ENST00000414413 ; STK36-010; intron 2
ENST00000295709 ; STK36-001; intron 10
ENST00000392105 ; STK36-002; intron 10
ENST00000440309 ; STK36-003; intron 10
ENST00000392106 ; STK36-201; intron 10
Database links

Mature sequence hsa-miR-3132

Accession MIMAT0014997
Sequence

8 - 

uggguagagaaggagcucagagga

 - 31

Get sequence
Deep sequencing89 reads, 31 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).