Stem-loop sequence hsa-mir-3130-3

AccessionMI0014149 (change log)
Symbol HGNC:MIR3130-3~withdrawn
DescriptionHomo sapiens miR-3130-3 stem-loop
Stem-loop
   u                               gu 
5'  gucaugucuuacccagucuccggugcagccu  u
    |||||||||||||||||||||||||||||||  g
3'  caguacagaaugggucagaggccacgucgga  u
   a                               ac 
Get sequence
Deep sequencing
1195 reads, 3.76 reads per million, 133 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-3130-5p

Accession MIMAT0014995
Sequence

13 - 

acccagucuccggugcagccu

 - 33

Get sequence
Deep sequencing2284 reads, 114 experiments
Evidence experimental;