Stem-loop sequence hsa-mir-3130-1

AccessionMI0014147 (change log)
Symbol HGNC:MIR3130-1
DescriptionHomo sapiens miR-3130-1 stem-loop
Gene family MIPF0000845; mir-3130
Literature search

2 open access papers mention hsa-mir-3130-1
(5 sentences)

5' cuugucaugucuuacccagucuccggugcagccu  u
   ||||||||||||||||||||||||||||||||||  g
3' gaacaguacagaaugggucagaggccacgucgga  u
Get sequence
Deep sequencing
1195 reads, 3.76 reads per million, 133 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 206783234-206783308 [-]
Clustered miRNAs
< 10kb from hsa-mir-3130-1
hsa-mir-3130-2chr2: 206783234-206783308 [+]
hsa-mir-3130-1chr2: 206783234-206783308 [-]
Database links

Mature sequence hsa-miR-3130-5p

Accession MIMAT0014995

13 - 


 - 33

Get sequence
Deep sequencing2284 reads, 114 experiments
Evidence experimental;

Mature sequence hsa-miR-3130-3p

Accession MIMAT0014994

44 - 


 - 64

Get sequence
Deep sequencing1244 reads, 85 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets


PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).