Stem-loop sequence hsa-mir-3129

AccessionMI0014146 (change log)
Symbol HGNC:MIR3129
DescriptionHomo sapiens miR-3129 stem-loop
Gene family MIPF0001458; mir-3129
Literature search

1 open access papers mention hsa-mir-3129
(73 sentences)

Stem-loop
   gua                            ccu   a 
5'    cuugggcaguaguguagagauugguuug   guu a
      ||||||||||||||||||||||||||||   |||  
3'    gaacccgucgucacaucucuaaucaaac   uaa u
   cga                            --u   g 
Get sequence
Deep sequencing
431 reads, 0 reads per million, 95 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 189133036-189133111 [-]
sense
OTTHUMT00000334695 ; AC068718.1-001; intron 1
OTTHUMT00000334696 ; AC068718.1-002; intron 1
ENST00000434418 ; LINC01090-001; intron 1
ENST00000415357 ; LINC01090-002; intron 1
Database links

Mature sequence hsa-miR-3129-5p

Accession MIMAT0014992
Previous IDshsa-miR-3129
Sequence

9 - 

gcaguaguguagagauugguuu

 - 30

Get sequence
Deep sequencing302 reads, 59 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

Mature sequence hsa-miR-3129-3p

Accession MIMAT0019202
Sequence

47 - 

aaacuaaucucuacacugcugc

 - 68

Get sequence
Deep sequencing127 reads, 61 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).