Stem-loop sequence hsa-mir-3128

AccessionMI0014145 (change log)
Symbol HGNC:MIR3128
DescriptionHomo sapiens miR-3128 stem-loop
Literature search

1 open access papers mention hsa-mir-3128
(1 sentences)

Stem-loop
   u    cug                      cc 
5'  uccu   gcaaguaaaaaacucucauuuu  u
    ||||   ||||||||||||||||||||||   
3'  agga   cguucauuuuuugagaguaaaa  u
   a    uaa                      aa 
Get sequence
Deep sequencing
151 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 177255945-177256010 [-]
intergenic
Database links

Mature sequence hsa-miR-3128

Accession MIMAT0014991
Sequence

5 - 

ucuggcaaguaaaaaacucucau

 - 27

Get sequence
Deep sequencing137 reads, 65 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).