Stem-loop sequence hsa-mir-3126

AccessionMI0014143 (change log)
Symbol HGNC:MIR3126
DescriptionHomo sapiens miR-3126 stem-loop
Gene family MIPF0001525; mir-3126
Literature search

1 open access papers mention hsa-mir-3126
(2 sentences)

Stem-loop
           a  a g   a         a   cuggu 
5' augauuau ug g gac gaugccaga gca     u
   |||||||| || | ||| ||||||||| |||      
3' uauuaaua ac c cug cuacggucu cgu     a
           g  a a   c         a   uuagu 
Get sequence
Deep sequencing
358 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 69103682-69103755 [+]
intergenic
Database links

Mature sequence hsa-miR-3126-5p

Accession MIMAT0014989
Sequence

10 - 

ugagggacagaugccagaagca

 - 31

Get sequence
Deep sequencing241 reads, 50 experiments
Evidence experimental; Illumina [2-4]
Database links
Predicted targets

Mature sequence hsa-miR-3126-3p

Accession MIMAT0015377
Sequence

46 - 

caucuggcauccgucacacaga

 - 67

Get sequence
Deep sequencing112 reads, 38 experiments
Evidence experimental; SOLiD [1], Illumina [4]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
4
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).