Stem-loop sequence hsa-mir-3125

AccessionMI0014142 (change log)
Symbol HGNC:MIR3125
DescriptionHomo sapiens miR-3125 stem-loop
Literature search

2 open access papers mention hsa-mir-3125
(4 sentences)

Stem-loop
      aau   ua       c  u   --ga    u       
5' gag   ggg  gaggaag ug gga    gaac cacggu 
   |||   |||  ||||||| || |||    |||| ||||| g
3' cuc   ucc  cuccuuc gc ccu    cuug gugucc 
      cuu   uc       c  c   agag    -       
Get sequence
Deep sequencing
273 reads, 9.33 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 12737367-12737444 [+]
intergenic
Database links

Mature sequence hsa-miR-3125

Accession MIMAT0014988
Sequence

10 - 

uagaggaagcuguggagaga

 - 29

Get sequence
Deep sequencing216 reads, 53 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).