Stem-loop sequence hsa-mir-3122

AccessionMI0014138 (change log)
Symbol HGNC:MIR3122
DescriptionHomo sapiens miR-3122 stem-loop
Gene family MIPF0001549; mir-3122
Stem-loop
            g  g        g  c         u 
5' accagcucu uu ggacaaga ga ggucuucuu u
   ||||||||| || |||||||| || ||||||||| g
3' uggucgaga aa ccuguucu cu ccagaagga g
            g  g        a  a         a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 212077613-212077685 [+]
intergenic
Database links

Mature sequence hsa-miR-3122

Accession MIMAT0014984
Sequence

10 - 

guugggacaagaggacggucuu

 - 31

Get sequence
Deep sequencing39 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).