Stem-loop sequence hsa-mir-3121

AccessionMI0014137 (change log)
Symbol HGNC:MIR3121
DescriptionHomo sapiens miR-3121 stem-loop
Gene family MIPF0001417; mir-3121
Literature search

1 open access papers mention hsa-mir-3121
(1 sentences)

Stem-loop
        guua                        --  a 
5' aaaug    uguccuuugccuauucuauuuaag  ac c
   |||||    ||||||||||||||||||||||||  || c
3' uuuac    acaggaaacggaugagauaaauuc  ug c
        aaag                        ca  u 
Get sequence
Deep sequencing
240 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 180438314-180438390 [-]
sense
OTTHUMT00000084998 ; ACBD6-001; intron 3
ENST00000367595 ; ACBD6-001; intron 3
Database links

Mature sequence hsa-miR-3121-5p

Accession MIMAT0019199
Sequence

12 - 

uccuuugccuauucuauuuaag

 - 33

Get sequence
Deep sequencing17 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-3121-3p

Accession MIMAT0014983
Previous IDshsa-miR-3121
Sequence

47 - 

uaaauagaguaggcaaaggaca

 - 68

Get sequence
Deep sequencing220 reads, 49 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).