Stem-loop sequence hsa-mir-3120

AccessionMI0014136 (change log)
Symbol HGNC:MIR3120
DescriptionHomo sapiens miR-3120 stem-loop
Gene family MIPF0000062; mir-214
Literature search

5 open access papers mention hsa-mir-3120
(6 sentences)

Stem-loop
           a           ug c      a    ugag 
5' gucaugug cugccugucug  c ugcugu cagg    c
   |||||||| |||||||||||  | |||||| ||||    g
3' caguacac gacggacagau  g acgaca gucu    g
           a           gu a      c    ugua 
Get sequence
Deep sequencing
265 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 172138808-172138888 [+]
sense
OTTHUMT00000378444 ; DNM3-008; intron 13
OTTHUMT00000084529 ; DNM3-001; intron 14
OTTHUMT00000378443 ; DNM3-007; intron 14
OTTHUMT00000084531 ; DNM3-003; intron 15
ENST00000523513 ; DNM3-008; intron 13
ENST00000367731 ; DNM3-001; intron 14
ENST00000520906 ; DNM3-007; intron 14
ENST00000358155 ; DNM3-201; intron 14
ENST00000355305 ; DNM3-003; intron 15
Clustered miRNAs
< 10kb from hsa-mir-3120
hsa-mir-214chr1: 172138798-172138907 [-]
hsa-mir-3120chr1: 172138808-172138888 [+]
hsa-mir-199a-2chr1: 172144535-172144644 [-]
Database links

Mature sequence hsa-miR-3120-5p

Accession MIMAT0019198
Sequence

13 - 

ccugucugugccugcuguaca

 - 33

Get sequence
Deep sequencing15 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3120-3p

Accession MIMAT0014982
Previous IDshsa-miR-3120
Sequence

51 - 

cacagcaaguguagacaggca

 - 71

Get sequence
Deep sequencing235 reads, 32 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).