Stem-loop sequence hsa-mir-3119-1

AccessionMI0014134 (change log)
Symbol HGNC:MIR3119-1
DescriptionHomo sapiens miR-3119-1 stem-loop
Gene family MIPF0000971; mir-3119
Stem-loop
          c                         g    cua 
5' auuaacu uggcuuuuaacuuugauggcaaagg guag   a
   ||||||| ||||||||||||||||||||||||| ||||   a
3' uaauuga accgaaaauugaaacuaccguuucu uauc   c
          u                         g    uaa 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 170151378-170151462 [-]
antisense
OTTHUMT00000087602 ; RP11-297H3.3-001; intron 1
ENST00000439184 ; RP11-297H3.3-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-3119-1
hsa-mir-3119-2chr1: 170151378-170151462 [+]
hsa-mir-3119-1chr1: 170151378-170151462 [-]
Database links

Mature sequence hsa-miR-3119

Accession MIMAT0014981
Sequence

9 - 

uggcuuuuaacuuugauggc

 - 28

Get sequence
Deep sequencing96 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).