Stem-loop sequence hsa-mir-3115

AccessionMI0014127 (change log)
Symbol HGNC:MIR3115
DescriptionHomo sapiens miR-3115 stem-loop
Stem-loop
       a    --       c         ----   a 
5' ucug auau  ggguuua uaguuggug    gug a
   |||| ||||  ||||||| |||||||||    |||  
3' agac ugua  uccggau aucaaccgc    uac u
       c    uu       u         ugag   u 
Get sequence
Deep sequencing
517 reads, 29.5 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 23044305-23044372 [+]
sense
OTTHUMT00000008059 ; EPHB2-003; intron 1
OTTHUMT00000008060 ; EPHB2-001; intron 1
OTTHUMT00000008061 ; EPHB2-002; intron 1
ENST00000374630 ; EPHB2-003; intron 1
ENST00000400191 ; EPHB2-001; intron 1
ENST00000374632 ; EPHB2-002; intron 1
ENST00000544305 ; EPHB2-201; intron 1
Database links

Mature sequence hsa-miR-3115

Accession MIMAT0014977
Sequence

6 - 

auauggguuuacuaguuggu

 - 25

Get sequence
Deep sequencing501 reads, 77 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).