Stem-loop sequence hsa-mir-3074

AccessionMI0014181 (change log)
Symbol HGNC:MIR3074
DescriptionHomo sapiens miR-3074 stem-loop
Gene family MIPF0001103; mir-3074
Literature search

4 open access papers mention hsa-mir-3074
(7 sentences)

Stem-loop
        -a    u  u        a    -gc    gugua 
5' gcucg  cucc gu ccugcuga cuga   cagu     a
   |||||  |||| || |||||||| ||||   ||||     a
3' ugggc  gagg ca ggaugacu gacu   guca     a
        gg    c  c        c    aua    agagu 
Get sequence
Deep sequencing
796 reads, 4.49 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 95086014-95086094 [-]
sense
OTTHUMT00000053075 ; NOL8-003; intron 1
OTTHUMT00000053082 ; NOL8-010; intron 1
OTTHUMT00000053080 ; NOL8-008; intron 1
OTTHUMT00000402688 ; NOL8-020; intron 1
OTTHUMT00000402689 ; NOL8-018; intron 1
OTTHUMT00000053078 ; NOL8-006; intron 2
OTTHUMT00000402683 ; NOL8-016; intron 2
OTTHUMT00000402684 ; NOL8-015; intron 2
OTTHUMT00000402685 ; NOL8-017; intron 2
OTTHUMT00000053076 ; NOL8-004; intron 2
OTTHUMT00000053077 ; NOL8-005; intron 2
OTTHUMT00000402687 ; NOL8-013; intron 2
OTTHUMT00000053079 ; NOL8-007; intron 2
OTTHUMT00000402693 ; NOL8-028; intron 2
OTTHUMT00000402690 ; NOL8-019; intron 2
OTTHUMT00000402691 ; NOL8-027; intron 2
OTTHUMT00000402692 ; NOL8-025; intron 2
OTTHUMT00000402694 ; NOL8-026; intron 2
OTTHUMT00000402695 ; NOL8-024; intron 2
OTTHUMT00000402696 ; NOL8-021; intron 2
OTTHUMT00000402697 ; NOL8-022; intron 2
OTTHUMT00000053074 ; NOL8-002; intron 2
OTTHUMT00000402698 ; NOL8-023; intron 2
OTTHUMT00000402682 ; NOL8-012; intron 3
ENST00000360868 ; NOL8-003; intron 1
ENST00000535387 ; NOL8-010; intron 1
ENST00000542053 ; NOL8-008; intron 1
ENST00000411621 ; NOL8-020; intron 1
ENST00000535807 ; NOL8-018; intron 1
ENST00000442668 ; NOL8-006; intron 2
ENST00000536593 ; NOL8-016; intron 2
ENST00000545558 ; NOL8-015; intron 2
ENST00000544867 ; NOL8-017; intron 2
ENST00000432670 ; NOL8-004; intron 2
ENST00000434228 ; NOL8-005; intron 2
ENST00000433029 ; NOL8-013; intron 2
ENST00000421075 ; NOL8-007; intron 2
ENST00000445919 ; NOL8-028; intron 2
ENST00000536624 ; NOL8-019; intron 2
ENST00000542613 ; NOL8-027; intron 2
ENST00000542573 ; NOL8-025; intron 2
ENST00000543260 ; NOL8-026; intron 2
ENST00000543985 ; NOL8-024; intron 2
ENST00000544321 ; NOL8-021; intron 2
ENST00000538215 ; NOL8-022; intron 2
ENST00000482475 ; NOL8-002; intron 2
ENST00000535649 ; NOL8-023; intron 2
ENST00000358855 ; NOL8-201; intron 2
ENST00000545444 ; NOL8-012; intron 3
Clustered miRNAs
< 10kb from hsa-mir-3074
hsa-mir-24-1chr9: 95086021-95086088 [+]
hsa-mir-3074chr9: 95086014-95086094 [-]
hsa-mir-27bchr9: 95085445-95085541 [+]
hsa-mir-23bchr9: 95085208-95085304 [+]
Database links

Mature sequence hsa-miR-3074-5p

Accession MIMAT0019208
Sequence

12 - 

guuccugcugaacugagccag

 - 32

Get sequence
Deep sequencing257 reads, 73 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-3074-3p

Accession MIMAT0015027
Previous IDshsa-miR-3074
Sequence

50 - 

gauaucagcucaguaggcaccg

 - 71

Get sequence
Deep sequencing533 reads, 55 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).