Stem-loop sequence hsa-mir-3065

AccessionMI0014228 (change log)
Symbol HGNC:MIR3065
DescriptionHomo sapiens miR-3065 stem-loop
Gene family MIPF0001105; mir-3065
Literature search

8 open access papers mention hsa-mir-3065
(49 sentences)

Stem-loop
      c            a   a   a     ------  g  g 
5' cug ccucuucaacaa auc cug ugcug      ga uc c
   ||| |||||||||||| ||| ||| |||||      || ||  
3' gac ggagagguuguu uag gac acgac      cu ag c
      a            a   -   c     ucacua  g  u 
Get sequence
Deep sequencing
24310 reads, 39.1 reads per million, 133 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 81125877-81125955 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3065
hsa-mir-657chr17: 81125276-81125373 [-]
hsa-mir-3065chr17: 81125877-81125955 [+]
hsa-mir-338chr17: 81125883-81125949 [-]
hsa-mir-1250chr17: 81133196-81133308 [-]
Database links

Mature sequence hsa-miR-3065-5p

Accession MIMAT0015066
Sequence

10 - 

ucaacaaaaucacugaugcugga

 - 32

Get sequence
Deep sequencing18870 reads, 127 experiments
Evidence experimental; Illumina [1,3], 454 [2]
Database links
Predicted targets

Mature sequence hsa-miR-3065-3p

Accession MIMAT0015378
Sequence

50 - 

ucagcaccaggauauuguuggag

 - 72

Get sequence
Deep sequencing5439 reads, 95 experiments
Evidence experimental; Illumina [1,3], 454 [2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).