Stem-loop sequence hsa-mir-301b

AccessionMI0005568 (change log)
Symbol HGNC:MIR301B
DescriptionHomo sapiens miR-301b stem-loop
Gene family MIPF0000034; mir-130
Literature search

62 open access papers mention hsa-mir-301b
(163 sentences)

Stem-loop
   ---g  g        c      ---g        a  gug u 
5'     cc caggugcu ugacga    guugcacu cu   c c
       || |||||||| ||||||    |||||||| ||   | u
3'     gg gucuacga acuguu    uaacguga ga   g g
   acca  -        a      auag        c  --a a 
Get sequence
Deep sequencing
42987 reads, 141 reads per million, 113 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 21652981-21653058 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-301b
hsa-mir-301bchr22: 21652981-21653058 [+]
hsa-mir-130bchr22: 21653304-21653385 [+]
Database links

Mature sequence hsa-miR-301b-5p

Accession MIMAT0032026
Sequence

10 - 

gcucugacgagguugcacuacu

 - 31

Get sequence
Deep sequencing115 reads, 32 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-301b-3p

Accession MIMAT0004958
Previous IDshsa-miR-301b
Sequence

45 - 

cagugcaaugauauugucaaagc

 - 67

Get sequence
Deep sequencing42860 reads, 111 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).