Stem-loop sequence hsa-mir-298

AccessionMI0005523 (change log)
Symbol HGNC:MIR298
DescriptionHomo sapiens miR-298 stem-loop
Gene family MIPF0000206; mir-298
Literature search

22 open access papers mention hsa-mir-298
(95 sentences)

Stem-loop
   ---   gg    c      --      ga     uc -    g uu 
5'    uca  ucuu agcaga  agcagg  gguuc  c cagu g  u
      |||  |||| ||||||  ||||||  |||||  | |||| |  u
3'    agu  agga ucguuu  ucgucc  ucaag  g guca u  c
   ucg   -g    c      cg      ga     ga u    g uc 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 58818226-58818313 [-]
antisense
OTTHUMT00000079949 ; RP5-1043L13.1-003; intron 1
OTTHUMT00000079950 ; RP5-1043L13.1-004; intron 1
OTTHUMT00000079957 ; RP5-1043L13.1-011; intron 1
OTTHUMT00000079948 ; RP5-1043L13.1-002; intron 3
OTTHUMT00000079947 ; RP5-1043L13.1-001; intron 3
OTTHUMT00000079953 ; RP5-1043L13.1-007; intron 7
ENST00000437035 ; RP5-1043L13.1-003; intron 1
ENST00000421257 ; RP5-1043L13.1-004; intron 1
ENST00000427820 ; RP5-1043L13.1-011; intron 1
ENST00000458422 ; RP5-1043L13.1-002; intron 3
ENST00000432910 ; RP5-1043L13.1-001; intron 3
ENST00000431181 ; RP5-1043L13.1-007; intron 7
Clustered miRNAs
< 10kb from hsa-mir-298
hsa-mir-298chr20: 58818226-58818313 [-]
hsa-mir-296chr20: 58817615-58817694 [-]
Database links

Mature sequence hsa-miR-298

Accession MIMAT0004901
Sequence

11 - 

agcagaagcagggagguucuccca

 - 34

Get sequence
Deep sequencing10 reads, 10 experiments
Evidence by similarity; MI0000398
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).