Stem-loop sequence hsa-mir-297

AccessionMI0005775 (change log)
Symbol HGNC:MIR297
DescriptionHomo sapiens miR-297 stem-loop
Gene family MIPF0000204; mir-297
Literature search

14 open access papers mention hsa-mir-297
(22 sentences)

Stem-loop
   u u       u       -             a 
5'  g auguaug gugcaug ugcauguaugugu u
    | ||||||| ||||||| |||||||||||||  
3'  c uauauac cauguau auguauauauaca a
   a -       u       u             u 
Get sequence
Deep sequencing
869 reads, 3.23 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The extents of the mature sequence are not absolutely determined in [1], but are predicted from mouse miR-297.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 110860582-110860647 [-]
antisense
OTTHUMT00000363798 ; EGF-002; intron 1
OTTHUMT00000255065 ; EGF-001; intron 1
OTTHUMT00000363799 ; EGF-003; intron 1
ENST00000509793 ; EGF-002; intron 1
ENST00000265171 ; EGF-001; intron 1
ENST00000503392 ; EGF-003; intron 1
Database links

Mature sequence hsa-miR-297

Accession MIMAT0004450
Sequence

4 - 

auguaugugugcaugugcaug

 - 24

Get sequence
Deep sequencing24 reads, 6 experiments
Evidence experimental; microarray [1], Northern [1]
Predicted targets

References

1
PMID:17322031 "Suppression of microRNA-silencing pathway by HIV-1 during virus replication" Triboulet R, Mari B, Lin YL, Chable-Bessia C, Bennasser Y, Lebrigand K, Cardinaud B, Maurin T, Barbry P, Baillat V, Reynes J, Corbeau P, Jeang KT, Benkirane M Science. 315:1579-1582(2007).