Stem-loop sequence hsa-mir-2909

AccessionMI0013083 (change log)
Symbol HGNC:MIR2909
DescriptionHomo sapiens miR-2909 stem-loop
Literature search

4 open access papers mention hsa-mir-2909
(4 sentences)

Stem-loop
   --         -gc     -  -      ucuuu  c 
5'   gguguuagg   caaca uc ucuugg     cc c
     |||||||||   ||||| || ||||||     || u
3'   ccgcaauuc   guugu gg agaacc     gg g
   ua         aac     c  u      ---cu  u 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was referred to as hmiR-che-1 in [1].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 37033745-37033813 [+]
sense
OTTHUMT00000256890 ; LASP1-001; intron 1
OTTHUMT00000442004 ; LASP1-003; intron 1
OTTHUMT00000442005 ; LASP1-004; intron 1
OTTHUMT00000442006 ; LASP1-005; intron 1
OTTHUMT00000256891 ; LASP1-002; intron 1
ENST00000318008 ; LASP1-001; intron 1
ENST00000585841 ; LASP1-003; intron 1
ENST00000584106 ; LASP1-004; intron 1
ENST00000443937 ; LASP1-005; intron 1
ENST00000419929 ; LASP1-002; intron 1
ENST00000435347 ; LASP1-202; intron 1
ENST00000433206 ; LASP1-201; intron 1
Database links

Mature sequence hsa-miR-2909

Accession MIMAT0013863
Sequence

4 - 

guuagggccaacaucucuugg

 - 24

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; qPCR [1]
Predicted targets

References

1
"Cellular AATF gene encodes a novel miRNA that can contribute to HIV-1 latency" Kaul D, Hussain A Indian J. Biochem. Biophys. 46:237-240(2009).
2
PMID:22504889 "Regulatory role of miR-2909 in cell-mediated immune response" Kaul D, Sasikala M, Raina A Cell Biochem Funct. 30:500-504(2012).