Stem-loop sequence hsa-mir-2681

AccessionMI0012062 (change log)
Symbol HGNC:MIR2681
DescriptionHomo sapiens miR-2681 stem-loop
Literature search

1 open access papers mention hsa-mir-2681
(1 sentences)

Stem-loop
   ----gcccccuu    c                 c     g  g    cccaa 
5'             uuca gcauuuguguuuuacca cucca ga acug     a
               |||| ||||||||||||||||| ||||| || ||||     g
3'             aagu cguagacacgaaauggu gaggu cu ugac     a
   gugcaacuuaau    a                 u     a  a    uucuc 
Get sequence
Deep sequencing
197 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 101967642-101967746 [-]
sense
OTTHUMT00000045663 ; NALCN-001; intron 7
OTTHUMT00000045664 ; NALCN-002; intron 7
OTTHUMT00000045665 ; NALCN-003; intron 7
ENST00000251127 ; NALCN-001; intron 7
ENST00000497170 ; NALCN-002; intron 7
ENST00000470333 ; NALCN-003; intron 7
ENST00000376196 ; NALCN-201; intron 7
Database links

Mature sequence hsa-miR-2681-5p

Accession MIMAT0013515
Previous IDshsa-miR-2681*
Sequence

22 - 

guuuuaccaccuccaggagacu

 - 43

Get sequence
Deep sequencing56 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-2681-3p

Accession MIMAT0013516
Previous IDshsa-miR-2681
Sequence

61 - 

uaucauggaguugguaaagcac

 - 82

Get sequence
Deep sequencing138 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).