Stem-loop sequence hsa-mir-2467

AccessionMI0017432 (change log)
Symbol HGNC:MIR2467
DescriptionHomo sapiens miR-2467 stem-loop
Literature search

1 open access papers mention hsa-mir-2467
(13 sentences)

Stem-loop
           a      g    g ua     g        ucc 
5' ggacaggc ccugag cucu u  gccuu gcucuggg   u
   |||||||| |||||| |||| |  ||||| ||||||||    
3' ucugucug ggacuc gaga a  cggag cgagauuc   g
           -      g    g --     a        cuc 
Get sequence
Deep sequencing
306 reads, 0 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 239351724-239351804 [-]
antisense
OTTHUMT00000328300 ; ASB1-007; intron 1
OTTHUMT00000328297 ; ASB1-004; intron 2
OTTHUMT00000328298 ; ASB1-005; intron 2
OTTHUMT00000328299 ; ASB1-006; intron 2
OTTHUMT00000328295 ; ASB1-002; intron 3
OTTHUMT00000328294 ; ASB1-001; intron 3
ENST00000468122 ; ASB1-007; intron 1
ENST00000409297 ; ASB1-004; intron 2
ENST00000438264 ; ASB1-005; intron 2
ENST00000491653 ; ASB1-006; intron 2
ENST00000463352 ; ASB1-002; intron 3
ENST00000264607 ; ASB1-001; intron 3
Database links

Mature sequence hsa-miR-2467-5p

Accession MIMAT0019952
Sequence

12 - 

ugaggcucuguuagccuuggcuc

 - 34

Get sequence
Deep sequencing177 reads, 49 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-2467-3p

Accession MIMAT0019953
Sequence

52 - 

agcagaggcagagaggcucagg

 - 73

Get sequence
Deep sequencing120 reads, 38 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).