Stem-loop sequence hsa-mir-23c

AccessionMI0016010 (change log)
Symbol HGNC:MIR23C
DescriptionHomo sapiens miR-23c stem-loop
Gene family MIPF0001429; mir-23c
Literature search

87 open access papers mention hsa-mir-23c
(148 sentences)

Stem-loop
   a  g       --a    -    --a  --    -  ---     -aa     gu 
5'  gu acuuucc   ggug ucac   ca  guga gu   ggcau   ucaga  a
    || |||||||   |||| ||||   ||  |||| ||   |||||   |||||   
3'  ca ugaaagg   ccau agug   gu  cacu ca   ccgua   aguuu  c
   g  g       aac    u    acc  ua    a  uac     cug     aa 
Get sequence
Deep sequencing
1330433 reads, 5.96e+03 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 20017088-20017187 [-]
intergenic
Database links

Mature sequence hsa-miR-23c

Accession MIMAT0018000
Sequence

66 - 

aucacauugccagugauuaccc

 - 87

Get sequence
Deep sequencing1330432 reads, 154 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1