Stem-loop sequence hsa-mir-2392

AccessionMI0016870 (change log)
Symbol HGNC:MIR2392
DescriptionHomo sapiens miR-2392 stem-loop
Gene family MIPF0001614; mir-2392
Literature search

2 open access papers mention hsa-mir-2392
(2 sentences)

Stem-loop
   a   uc    cca    ag      cu   a  --a       c 
5'  ugg  ccuc   aucc  ccauuc  cag cc   gguggcu c
    |||  ||||   ||||  ||||||  ||| ||   |||||||  
3'  auc  ggag   uggg  gguagg  guc gg   ccaccga c
   g   gu    -ag    --      au   -  acc       g 
Get sequence
Deep sequencing
372 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100814491-100814574 [+]
sense
OTTHUMT00000414306 ; RP11-638I2.8-001; intron 1
ENST00000557226 ; RP11-638I2.8-001; intron 1
antisense
OTTHUMT00000414241 ; WARS-041; intron 1
OTTHUMT00000414235 ; WARS-004; intron 5
OTTHUMT00000414237 ; WARS-006; intron 5
OTTHUMT00000414244 ; WARS-025; intron 5
OTTHUMT00000414234 ; WARS-001; intron 6
OTTHUMT00000414236 ; WARS-005; intron 6
OTTHUMT00000414239 ; WARS-003; intron 6
OTTHUMT00000414245 ; WARS-020; intron 6
OTTHUMT00000414238 ; WARS-007; intron 7
ENST00000554950 ; WARS-041; intron 1
ENST00000358655 ; WARS-004; intron 5
ENST00000344102 ; WARS-006; intron 5
ENST00000553395 ; WARS-025; intron 5
ENST00000392882 ; WARS-001; intron 6
ENST00000355338 ; WARS-005; intron 6
ENST00000556645 ; WARS-003; intron 6
ENST00000556504 ; WARS-020; intron 6
ENST00000557135 ; WARS-007; intron 7
Database links

Mature sequence hsa-miR-2392

Accession MIMAT0019043
Sequence

61 - 

uaggaugggggugagaggug

 - 80

Get sequence
Deep sequencing362 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).