Stem-loop sequence hsa-mir-2355

AccessionMI0015873 (change log)
Symbol HGNC:MIR2355
DescriptionHomo sapiens miR-2355 stem-loop
Gene family MIPF0000938; mir-2355
Literature search

3 open access papers mention hsa-mir-2355
(8 sentences)

Stem-loop
   --   ac    c   c       -   u     au       uau 
5'   cag  gugu auc ccagaua caa ggaca  augcuau   a
     |||  |||| ||| ||||||| ||| |||||  |||||||   a
3'   guc  caua uag gguuugu guu ccugu  uacggua   u
   ca   gu    a   a       c   -     --       ugc 
Get sequence
Deep sequencing
4936 reads, 10.5 reads per million, 152 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 207109987-207110073 [-]
intergenic
Database links

Mature sequence hsa-miR-2355-5p

Accession MIMAT0016895
Previous IDshsa-miR-2355
Sequence

11 - 

auccccagauacaauggacaa

 - 31

Get sequence
Deep sequencing2384 reads, 140 experiments
Evidence experimental; SOLiD [1], Illumina [2-3,5], Northern [4]
Database links
Predicted targets

Mature sequence hsa-miR-2355-3p

Accession MIMAT0017950
Sequence

54 - 

auuguccuugcuguuuggagau

 - 75

Get sequence
Deep sequencing2549 reads, 144 experiments
Evidence experimental; Illumina [2-3,5], Northern [4]
Database links
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
4
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
5
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).