Stem-loop sequence hsa-mir-2276

AccessionMI0011282 (change log)
Symbol HGNC:MIR2276
DescriptionHomo sapiens miR-2276 stem-loop
Literature search

2 open access papers mention hsa-mir-2276
(2 sentences)

Stem-loop
       -u  u   g   g -      u   c         gcu   u 
5' gugu  cu cca ucc c ccucug cac uugcagacg   uuc c
   ||||  || ||| ||| | |||||| ||| |||||||||   ||| u
3' uacg  ga ggu agg g ggagac gug aacgucugu   aag c
       uc  c   g   a c      u   -         ---   c 
Get sequence
Deep sequencing
266 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 24162416-24162504 [+]
sense
OTTHUMT00000044159 ; TNFRSF19-004; intron 1
OTTHUMT00000044156 ; TNFRSF19-001; intron 1
OTTHUMT00000044157 ; TNFRSF19-002; intron 1
OTTHUMT00000044158 ; TNFRSF19-003; intron 2
ENST00000248484 ; TNFRSF19-004; intron 1
ENST00000382258 ; TNFRSF19-001; intron 1
ENST00000382263 ; TNFRSF19-002; intron 1
ENST00000403372 ; TNFRSF19-201; intron 1
ENST00000464735 ; TNFRSF19-003; intron 2
Database links

Mature sequence hsa-miR-2276-5p

Accession MIMAT0026921
Sequence

16 - 

gcccucugucaccuugcagacg

 - 37

Get sequence
Deep sequencing61 reads, 30 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-2276-3p

Accession MIMAT0011775
Sequence

54 - 

ucugcaagugucagaggcgagg

 - 75

Get sequence
Deep sequencing204 reads, 53 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).