Stem-loop sequence hsa-mir-219b

AccessionMI0017299 (change log)
Symbol HGNC:MIR219B
DescriptionHomo sapiens miR-219b stem-loop
Gene family MIPF0000044; mir-219
Literature search

70 open access papers mention hsa-mir-219b
(245 sentences)

Stem-loop
     a   ca     a   -      c a       ------------   u 
5' gg gcu  gccac gau guccag c caauucu            cgg u
   || |||  ||||| ||| |||||| | |||||||            |||  
3' cc cga  cggug cua cagguu g guuaaga            gcc g
     -   ag     a   a      u c       acaugcucagac   g 
Get sequence
Deep sequencing
546 reads, 0 reads per million, 98 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 128392621-128392708 [+]
antisense
OTTHUMT00000054088 ; MAPKAP1-005; intron 1
OTTHUMT00000355310 ; MAPKAP1-017; intron 1
OTTHUMT00000054096 ; MAPKAP1-013; intron 2
OTTHUMT00000355307 ; MAPKAP1-014; intron 2
OTTHUMT00000054094 ; MAPKAP1-011; intron 2
OTTHUMT00000054092 ; MAPKAP1-009; intron 3
OTTHUMT00000054091 ; MAPKAP1-008; intron 3
OTTHUMT00000355308 ; MAPKAP1-015; intron 4
OTTHUMT00000054090 ; MAPKAP1-007; intron 4
OTTHUMT00000054086 ; MAPKAP1-003; intron 4
ENST00000420643 ; MAPKAP1-005; intron 1
ENST00000473837 ; MAPKAP1-017; intron 1
ENST00000373497 ; MAPKAP1-202; intron 1
ENST00000427078 ; MAPKAP1-013; intron 2
ENST00000468896 ; MAPKAP1-014; intron 2
ENST00000448439 ; MAPKAP1-011; intron 2
ENST00000394063 ; MAPKAP1-203; intron 2
ENST00000373498 ; MAPKAP1-009; intron 3
ENST00000373503 ; MAPKAP1-008; intron 3
ENST00000373511 ; MAPKAP1-015; intron 4
ENST00000350766 ; MAPKAP1-007; intron 4
ENST00000394060 ; MAPKAP1-003; intron 4
ENST00000265960 ; MAPKAP1-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-219b
hsa-mir-219a-2chr9: 128392618-128392714 [-]
hsa-mir-219bchr9: 128392621-128392708 [+]
Database links

Mature sequence hsa-miR-219b-5p

Accession MIMAT0019747
Sequence

14 - 

agauguccagccacaauucucg

 - 35

Get sequence
Deep sequencing247 reads, 76 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-219b-3p

Accession MIMAT0019748
Sequence

56 - 

agaauugcguuuggacaaucagu

 - 78

Get sequence
Deep sequencing298 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).