Stem-loop sequence hsa-mir-2117

AccessionMI0010636 (change log)
Symbol HGNC:MIR2117
DescriptionHomo sapiens miR-2117 stem-loop
Literature search

3 open access papers mention hsa-mir-2117
(5 sentences)

Stem-loop
   gcucu    uacu       --    u  u       --a  a 
5'      gauu    ucugucc  ggca gg gaacagc   gg u
        ||||    |||||||  |||| || |||||||   || u
3'      cuag    agacagg  ccgu uc cuugucg   uc g
   ----u    -ucu       aa    u  u       aug  g 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 43444806-43444885 [+]
intergenic
Database links

Mature sequence hsa-miR-2117

Accession MIMAT0011162
Sequence

51 - 

uguucucuuugccaaggacag

 - 71

Get sequence
Deep sequencing15 reads, 11 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).