Stem-loop sequence hsa-mir-2116

AccessionMI0010635 (change log)
Symbol HGNC:MIR2116
DescriptionHomo sapiens miR-2116 stem-loop
Literature search

3 open access papers mention hsa-mir-2116
(3 sentences)

Stem-loop
   ga     g  a         a    a     u    cca 
5'   ccuag cu gggguucuu gcau ggagg cuuc   u
     ||||| || ||||||||| |||| ||||| ||||   g
3'   ggauc ga ccucaagaa cgua ccucc gaag   c
   -a     a  c         c    c     u    aau 
Get sequence
Deep sequencing
430 reads, 0.99 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 59171183-59171262 [-]
sense
OTTHUMT00000157124 ; SLTM-001; 3'UTR (exon 21)
ENST00000380516 ; SLTM-001; 3'UTR (exon 21)
antisense
OTTHUMT00000416009 ; RNF111-007; intron 1
ENST00000559757 ; RNF111-007; intron 1
Database links

Mature sequence hsa-miR-2116-5p

Accession MIMAT0011160
Previous IDshsa-miR-2116
Sequence

14 - 

gguucuuagcauaggaggucu

 - 34

Get sequence
Deep sequencing130 reads, 55 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence hsa-miR-2116-3p

Accession MIMAT0011161
Previous IDshsa-miR-2116*
Sequence

51 - 

ccucccaugccaagaacuccc

 - 71

Get sequence
Deep sequencing295 reads, 86 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).