Stem-loop sequence hsa-mir-2115

AccessionMI0010634 (change log)
Symbol HGNC:MIR2115
DescriptionHomo sapiens miR-2115 stem-loop
Literature search

5 open access papers mention hsa-mir-2115
(5 sentences)

Stem-loop
   acuguc    - --        c           cuc        ggaa  a 
5'       aucc c  acugcuuc agcuuccauga   cugaugga    uc c
         |||| |  |||||||| |||||||||||   ||||||||    ||  
3'       uagg g  ugacgaag ucggagguacu   gacuacuu    ag a
   auuuac    a ua        a           uaa        ---a  u 
Get sequence
Deep sequencing
514 reads, 1.43 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 48316360-48316459 [-]
antisense
OTTHUMT00000346127 ; ZNF589-004; intron 3
OTTHUMT00000346126 ; ZNF589-003; intron 3
OTTHUMT00000346125 ; ZNF589-002; intron 4
OTTHUMT00000346128 ; ZNF589-005; intron 4
ENST00000427617 ; ZNF589-004; intron 3
ENST00000412564 ; ZNF589-003; intron 3
ENST00000440261 ; ZNF589-002; intron 4
ENST00000448461 ; ZNF589-005; intron 4
Database links

Mature sequence hsa-miR-2115-5p

Accession MIMAT0011158
Previous IDshsa-miR-2115
Sequence

21 - 

agcuuccaugacuccugaugga

 - 42

Get sequence
Deep sequencing169 reads, 54 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

Mature sequence hsa-miR-2115-3p

Accession MIMAT0011159
Previous IDshsa-miR-2115*
Sequence

58 - 

caucagaauucauggaggcuag

 - 79

Get sequence
Deep sequencing316 reads, 48 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).