Stem-loop sequence hsa-mir-2114

AccessionMI0010633 (change log)
Symbol HGNC:MIR2114
DescriptionHomo sapiens miR-2114 stem-loop
Gene family MIPF0001464; mir-2114
Literature search

1 open access papers mention hsa-mir-2114
(3 sentences)

Stem-loop
     u   u   ccu        c     a  -g    gaua 
5' cc cca gcu   agucccuu cuuga gc  gucg    a
   || ||| |||   |||||||| ||||| ||  ||||     
3' gg ggu cga   ucagggaa gaacu cg  cagu    u
     u   -   acu        c     c  ag    acac 
Get sequence
Deep sequencing
426 reads, 0 reads per million, 81 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 150228004-150228083 [+]
intergenic
Database links

Mature sequence hsa-miR-2114-5p

Accession MIMAT0011156
Previous IDshsa-miR-2114
Sequence

13 - 

uagucccuuccuugaagcgguc

 - 34

Get sequence
Deep sequencing333 reads, 71 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

Mature sequence hsa-miR-2114-3p

Accession MIMAT0011157
Previous IDshsa-miR-2114*
Sequence

49 - 

cgagccucaagcaagggacuu

 - 69

Get sequence
Deep sequencing89 reads, 35 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

References

1
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).