Stem-loop sequence hsa-mir-2113

AccessionMI0003939 (change log)
Symbol HGNC:MIR2113
DescriptionHomo sapiens miR-2113 stem-loop
Literature search

3 open access papers mention hsa-mir-2113
(4 sentences)

Stem-loop
   u        caa           ua    g        cg   a 
5'  uuucaaag   ugugugacagg  cagg acaaaucc  uua u
    ||||||||   |||||||||||  |||| ||||||||  ||| a
3'  aaaguuuc   guacacugucu  guuc uguuuagg  aau a
   a        acc           cg    g        ag   g 
Get sequence
Deep sequencing
57 reads, 8.33 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by qRT-PCR [2]. This sequence is named MID246 in [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 98024531-98024621 [+]
intergenic
Database links

Mature sequence hsa-miR-2113

Accession MIMAT0009206
Sequence

56 - 

auuugugcuuggcucugucac

 - 76

Get sequence
Deep sequencing53 reads, 9 experiments
Evidence experimental; qRT-PCR [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:19015728 "MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells" Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E PLoS One. 3:e3726(2008).