Stem-loop sequence hsa-mir-2110

AccessionMI0010629 (change log)
Symbol HGNC:MIR2110
DescriptionHomo sapiens miR-2110 stem-loop
Gene family MIPF0001399; mir-2110
Literature search

5 open access papers mention hsa-mir-2110
(8 sentences)

Stem-loop
          uu       c      --    u  g   u 
5' caggggu  ggggaaa ggccgc  ugag ga gcg c
   |||||||  ||||||| ||||||  |||| || ||| g
3' guucuca  cuccuuu cuggcg  acuc uu ugu g
          cc       u      cc    u  g   c 
Get sequence
Deep sequencing
10995 reads, 11.9 reads per million, 151 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Zhu et al. incorrectly referred to this sequence as mir-1309 in [1]. This sequence is unrelated to MIR1309 in plants.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 114174105-114174179 [-]
sense
OTTHUMT00000468643 ; RP11-324O2.6-001; intron 2
ENST00000424422 ; RP11-324O2.6-001; intron 2
antisense
OTTHUMT00000050391 ; ACSL5-006; intron 3
OTTHUMT00000050389 ; ACSL5-004; intron 5
OTTHUMT00000050387 ; ACSL5-002; intron 12
OTTHUMT00000050386 ; ACSL5-001; intron 12
ENST00000467340 ; ACSL5-006; intron 3
ENST00000495539 ; ACSL5-004; intron 5
ENST00000369410 ; ACSL5-202; intron 7
ENST00000354655 ; ACSL5-002; intron 12
ENST00000354273 ; ACSL5-001; intron 12
ENST00000356116 ; ACSL5-201; intron 12
ENST00000393081 ; ACSL5-203; intron 12
ENST00000433418 ; ACSL5-204; intron 12
Database links

Mature sequence hsa-miR-2110

Accession MIMAT0010133
Sequence

8 - 

uuggggaaacggccgcugagug

 - 29

Get sequence
Deep sequencing10267 reads, 146 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).