Stem-loop sequence hsa-mir-2054

AccessionMI0010488 (change log)
Symbol HGNC:MIR2054
DescriptionHomo sapiens miR-2054 stem-loop
Literature search

1 open access papers mention hsa-mir-2054
(1 sentences)

Stem-loop
             -aa      uuauu 
5' cuguaauaua   uuuaau     c
   ||||||||||   ||||||      
3' gacauuaugu   aaauua     u
             aaa      cuauc 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 125507259-125507307 [+]
intergenic
Database links

Mature sequence hsa-miR-2054

Accession MIMAT0009979
Sequence

1 - 

cuguaauauaaauuuaauuuauu

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1], PCR [1]
Predicted targets

References

1
PMID:18952845 "Prediction of human miRNAs using tissue-selective motifs in 3' UTRs" Chang YM, Juan HF, Lee TY, Chang YY, Yeh YM, Li WH, Shih AC Proc Natl Acad Sci U S A. 105:17061-17066(2008).