Stem-loop sequence hsa-mir-2053

AccessionMI0010487 (change log)
Symbol HGNC:MIR2053
DescriptionHomo sapiens miR-2053 stem-loop
Stem-loop
        c         c  a               -caacc   ga 
5' cuugc auguaaaua ag uuuaauuaacauuug      ugu  a
   ||||| ||||||||| || |||||||||||||||      |||   
3' gaacg uacauuuau uc aaauuaauugugaau      acg  g
        a         c  c               uucaaa   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 112643493-112643583 [+]
intergenic
Database links

Mature sequence hsa-miR-2053

Accession MIMAT0009978
Sequence

61 - 

guguuaauuaaaccucuauuuac

 - 83

Get sequence
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:18952845 "Prediction of human miRNAs using tissue-selective motifs in 3' UTRs" Chang YM, Juan HF, Lee TY, Chang YY, Yeh YM, Li WH, Shih AC Proc Natl Acad Sci U S A. 105:17061-17066(2008).