Stem-loop sequence hsa-mir-2052

AccessionMI0010486 (change log)
Symbol HGNC:MIR2052
DescriptionHomo sapiens miR-2052 stem-loop
Literature search

1 open access papers mention hsa-mir-2052
(2 sentences)

Stem-loop
   c          a -a     gucccuu 
5'  uguuuugaua c  guaau       u
    |||||||||| |  |||||        
3'  acaaaacuau g  cauug       a
   a          c ac     aaacuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 74705693-74705747 [+]
antisense
OTTHUMT00000379080 ; UBE2W-004; intron 4
OTTHUMT00000413292 ; RP11-463D19.2-001; intron 5
OTTHUMT00000379081 ; UBE2W-003; 3'UTR (exon 5)
OTTHUMT00000379082 ; UBE2W-001; 3'UTR (exon 6)
OTTHUMT00000379083 ; UBE2W-002; 3'UTR (exon 7)
ENST00000523278 ; UBE2W-004; intron 4
ENST00000358757 ; RP11-463D19.2-001; intron 5
ENST00000422906 ; UBE2W-003; 3'UTR (exon 5)
ENST00000453587 ; UBE2W-201; intron 5
ENST00000517608 ; UBE2W-001; 3'UTR (exon 6)
ENST00000602593 ; UBE2W-202; 3'UTR (exon 6)
ENST00000419880 ; UBE2W-002; 3'UTR (exon 7)
ENST00000602969 ; UBE2W-203; 3'UTR (exon 7)
Database links

Mature sequence hsa-miR-2052

Accession MIMAT0009977
Sequence

2 - 

uguuuugauaacaguaaugu

 - 21

Get sequence
Evidence experimental; cloned [1], PCR [1]
Predicted targets

References

1
PMID:18952845 "Prediction of human miRNAs using tissue-selective motifs in 3' UTRs" Chang YM, Juan HF, Lee TY, Chang YY, Yeh YM, Li WH, Shih AC Proc Natl Acad Sci U S A. 105:17061-17066(2008).