Stem-loop sequence hsa-mir-1976

AccessionMI0009986 (change log)
Symbol HGNC:MIR1976
DescriptionHomo sapiens miR-1976 stem-loop
Gene family MIPF0001633; mir-1976
Literature search

3 open access papers mention hsa-mir-1976
(12 sentences)

Stem-loop
             a        uc uaa 
5' gcagcaagga ggcagggg  c   g
   |||||||||| ||||||||  |    
3' ugucguuccu ccguccuc  g   g
             c        cu ugu 
Get sequence
Deep sequencing
178 reads, 1.75 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 26554542-26554593 [+]
sense
OTTHUMT00000009505 ; RP11-231P20.2-002; intron 3
ENST00000451482 ; RP11-231P20.2-002; intron 3
Database links

Mature sequence hsa-miR-1976

Accession MIMAT0009451
Sequence

33 - 

ccuccugcccuccuugcugu

 - 52

Get sequence
Deep sequencing120 reads, 40 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18923441 "Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia" Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R, den Boer ML Leukemia. 23:313-322(2009).