Stem-loop sequence hsa-mir-1915

AccessionMI0008336 (change log)
Symbol HGNC:MIR1915
DescriptionHomo sapiens miR-1915 stem-loop
Gene family MIPF0001037; mir-1915
Literature search

20 open access papers mention hsa-mir-1915
(31 sentences)

Stem-loop
   ---ug  a      a       u  c     --     g   a 
5'      ag ggccgc ccuugcc ug ugccc  gggcc ugc c
        || |||||| ||||||| || |||||  ||||| |||  
3'      uc ccggcg ggggcgg gc gcggg  cccgg gug c
   agcga  -      -       c  a     ac     -   c 
Get sequence
Deep sequencing
255 reads, 3.45 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 21496562-21496641 [-]
intergenic
Database links

Mature sequence hsa-miR-1915-5p

Accession MIMAT0007891
Previous IDshsa-miR-1915*
Sequence

12 - 

accuugccuugcugcccgggcc

 - 33

Get sequence
Deep sequencing48 reads, 16 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence hsa-miR-1915-3p

Accession MIMAT0007892
Previous IDshsa-miR-1915
Sequence

47 - 

ccccagggcgacgcggcggg

 - 66

Get sequence
Deep sequencing25 reads, 20 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).