Stem-loop sequence hsa-mir-1914

AccessionMI0008335 (change log)
Symbol HGNC:MIR1914
DescriptionHomo sapiens miR-1914 stem-loop
Gene family MIPF0001040; mir-1914
Literature search

6 open access papers mention hsa-mir-1914
(11 sentences)

Stem-loop
   c   u a    -g   u    cc     a       uucc 
5'  gug g gccc  ccc gugc  ggccc cuucugc    u
    ||| | ||||  ||| ||||  ||||| |||||||    c
3'  cac c cggg  ggg cacg  cuggg gaggacg    u
   -   u c    ga   u    cc     -       cgau 
Get sequence
Deep sequencing
195 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 63941465-63941544 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1914
hsa-mir-647chr20: 63942631-63942726 [-]
hsa-mir-1914chr20: 63941465-63941544 [-]
Database links

Mature sequence hsa-miR-1914-5p

Accession MIMAT0007889
Previous IDshsa-miR-1914
Sequence

13 - 

cccugugcccggcccacuucug

 - 34

Get sequence
Deep sequencing39 reads, 26 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence hsa-miR-1914-3p

Accession MIMAT0007890
Previous IDshsa-miR-1914*
Sequence

50 - 

ggaggggucccgcacugggagg

 - 71

Get sequence
Deep sequencing140 reads, 24 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).