Stem-loop sequence hsa-mir-1913

AccessionMI0008334 (change log)
Symbol HGNC:MIR1913
DescriptionHomo sapiens miR-1913 stem-loop
Gene family MIPF0001015; mir-1913
Literature search

3 open access papers mention hsa-mir-1913
(3 sentences)

Stem-loop
      -u    cucc      a     cu      -gc   c 
5' acc  cuac    cggcag ggagg  gcagag   ugg u
   |||  ||||    |||||| |||||  ||||||   |||  
3' ugg  ggug    gucguc ccucc  cgucuc   acc u
      uc    aacc      g     cc      aaa   u 
Get sequence
Deep sequencing
254 reads, 2.56 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 166509354-166509433 [-]
intergenic
Database links

Mature sequence hsa-miR-1913

Accession MIMAT0007888
Sequence

49 - 

ucugcccccuccgcugcugcca

 - 70

Get sequence
Deep sequencing39 reads, 31 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).